Sale!

AFT™ Linked-Reads Raw Blood WGS Library Preparation Kit- 24 rxn

$1,599.00 $399.00

Description

AFT™ Linked-Reads Raw Blood WGS Library Preparation Kit seamlessly integrates the blood DNA extraction, Amplification, Fragmentation, and Tagging into one reaction, achieves ultimate efficiency in animal DNA sequencing Library preparation. All it takes is 1 uL of blood. The simple workflow comprises of 3 functional steps: blood cells lysis, AFT reaction of one hour at 45° C, and Library PCR of 16 cycles, there is also a SPRI beads-based purification before and after Library PCR step.

Kit Components

ComponentVolume (uL)
Lysis Solution84
Stop Solution12
DNA Denaturant12
2x AFT(TM) buffer120
AFT(TM) eyzymes12
2x PCR Master Mix600
i501 primer, 10uM60
i701 primer, 10uM60

Answered Question

Do I need to purify the blood cell DNA for AFT reaction?

No. The strand displacing amplification of AFT reaction tolerates impurities in whole blood very well, but not well enough to take even 1uL of the whole blood as direct input, it however works perfectly with 1uL of 1:10 diluted in water.

At what temperature is the kit shipped?

The kit is shipped on gel ice for within US and dry ice for international delivery.
The kit should be stored at -20 °C on receipt.

Can I use 3rd party or homebrew index primer sets to amplify the library?

Yes. If multiplexing, pick and record the index primers from index primer kits (third-party vendor, NEB E7600S, etc.).​ Be careful in selecting third-party index primers; some index primers are based on Nextera transposase recognition sites, not the standard Illumina Read1 and Read2 primer sequences. The correct index primer structures should be like below:
P5(AATGATACGGCGACCACCGAGATCTACAC)-i5-Read1(ACACTCTTTCCCTACACGACGCTCTTCCGATCT)
P7(CAAGCAGAAGACGGCATACGAGAT)-i7-Read2(GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)
Also, make sure the primers are at 10 uM concentration.

What’s the minimal length of the target DNA?

>1,000 bp. Using DNA ladders that include fragments from 100 bp to 50,000bp, we found only when > 1,000 did the fragments get represented in the sequencing library generated by AFT™ Library Prep kit.

I didn't see the library smear

The possible reasons could be:

 1). The DNA might be degraded and reduced to less than 1 kb; AFT ™ technology prefers to work on DNA longer than 1 kb. Try to keep blood sample on ice or store at low temperature until the library preparation.

3). Excessive pipetting and vortexing during the workflow might reduce the target DNA to shorter than 1 kb, avoid excessive pipetting or vortexing.

4) When recovering the elution from SPRI beads, leave at least 3 uL behind, don’t try to recover all.

5). The third-party index primers are not compatible; some index primers are based on Nextera transposase recognition sites, not the standard Illumina Read1 and Read2 sequences.  The correct index primer structures should be like below:

P5(AATGATACGGCGACCACCGAGATCTACAC)-i5-Read1(ACACTCTTTCCCTACACGACGCTCTTCCGATCT)

P7(CAAGCAGAAGACGGCATACGAGAT)-i7-Read2(GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)

Cluster density was low

White cell counts vary dramatically among individuals, try to run PCR with one or two more cycles.

PCR duplication rate is high

The PCR duplication rate from AFT™ kit is normally very low, less than 3%, you may underestimate the input DNA amount and run PCR with too many cycles, try to use fewer PCR cycles, as long as the library has a molar concentration of greater than 1 nM for 250-500 bp range, it will be sufficient for a sequencing.

Questions?

Manual download

Manual: AFT™ Linked-Reads Raw Blood WGS Library Preparation Kit

Video