Sale!

AFT™ Linked-Reads Raw Sample Metagenomics Library Preparation Kit- 24 rxn

$1,599.00 $399.00

Description

AFT™ Linked-Reads Raw Sample Metagenomics Library Preparation Kit seamlessly integrates the environmental sample microbial DNA extraction, Amplification, Fragmentation, and Tagging into one reaction, achieves ultimate efficiency in metagenomics Library preparation. The simple workflow comprises of 3 functional steps: microbial cells lysis, AFT reaction of one hour at 45° C, and Library PCR of 16 cycles, there is also a SPRI beads-based purification before and after Library PCR step.

Kit Components

ComponentVolume (uL)
Lysis Solution84
Stop Solution12
DNA Denaturant12
2x AFT(TM) buffer120
AFT(TM) eyzymes12
2x PCR Master Mix600
i501 primer, 10uM60
i701 primer, 10uM60

Answered Questions

Do I need to purify the microbial nucleic acids for AFT reaction?

No. The strand displacing amplification of AFT reaction tolerates impurities from environmental samples very well.

At what temperature is the kit shipped?

The kit is shipped on gel ice for within US and dry ice for international delivery.
The kit should be stored at -20 °C on receipt.

Can I use 3rd party or homebrew index primer sets to amplify the library?

Yes. If multiplexing, pick and record the index primers from index primer kits (third-party vendor, NEB E7600S, etc.).​ Be careful in selecting third-party index primers; some index primers are based on Nextera transposase recognition sites, not the standard Illumina Read1 and Read2 primer sequences. The correct index primer structures should be like below:
P5(AATGATACGGCGACCACCGAGATCTACAC)-i5-Read1(ACACTCTTTCCCTACACGACGCTCTTCCGATCT)
P7(CAAGCAGAAGACGGCATACGAGAT)-i7-Read2(GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)
Also, make sure the primers are at 10 uM concentration.

What’s the minimal length of the target DNA?

>1,000 bp. Using DNA ladders that include fragments from 100 bp to 50,000bp, we found only when > 1,000 did the fragments get represented in the sequencing library generated by AFT™ Library Prep kit.

Can I use the AFT™ Library Prep kit for degraded DNA samples?

No. The strand displacement amplification step of the workflow requires the template DNA to be long enough, at least 1,000 bp and longer. 

I didn't see the library

1). The DNA might be degraded and reduced to less than 1 kb; AFT ™ technology prefers to work on DNA longer than 1 kb. Try to keep environmental sample at cool temperature before the procedure.

2). Excessive pipetting and vortexing during the workflow might reduce the target DNA to shorter than 1 kb, avoid excessive pipetting or vortexing.

3) When recovering the elution from SPRI beads, leave at least 3 uL behind, don’t try to recover all.

4). The third-party index primers are not compatible; some index primers are based on Nextera transposase recognition sites, not the standard Illumina Read1 and Read2 sequences.  The correct index primer structures should be like below:

P5(AATGATACGGCGACCACCGAGATCTACAC)-i5-Read1(ACACTCTTTCCCTACACGACGCTCTTCCGATCT)

P7(CAAGCAGAAGACGGCATACGAGAT)-i7-Read2(GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)

Cluster density low

Microbial burden vary dramatically among different environmental samples, try to run PCR with one or two more cycles.

PCR duplication rate is high

The PCR duplication rate from AFT™ kit is normally very low, less than 3%, you may underestimate the input DNA amount and run PCR with too many cycles, try to use fewer PCR cycles, as long as the library has a molar concentration of greater than 1 nM for 250-500 bp range, it will be sufficient for a sequencing.

Questions?

Manual download

Manual: AFT™ Linked-Reads Raw Sample Metagenomics Library Preparation Kit

Video