Sale!

AFT™ Linked-Reads Single-Cell Whole-Genome Library Preparation Kit – 24 rxn

$1,599.00 $399.00

Description

AFT™ Linked-Reads Single-Cell Whole-Genome Library preparation technology seamlessly integrates the Amplification, Fragmentation, and Tagging of target DNA from a single cell into one reaction, achieves ultimate efficiency in single cell DNA sequencing Library preparation. The simple workflow comprises of 3 functional steps: Single cell lysis, AFT reaction of one hour at 45° C, and Library PCR of 16 cycles, there is also a SPRI beads-based purification before and after Library PCR step.

Kit Components

ComponentVolume (uL)
Lysis Solution84
Stop Solution12
DNA Denaturant12
2x AFT(TM) buffer120
AFT(TM) eyzymes12
2x PCR Master Mix600
i501 primer, 10uM60
i701 primer, 10uM60

Answered Questions

Do I need to purify the cell lysates for AFT reaction?

No. The strand displacing amplification tolerates impurities in crude lysates very well.

At what temperature is the kit shipped?

Shipped on gel ice, needs to be kept at -20 °C or lower on receiving.

Can I use 3rd party or homebrew index primer sets to amplify the library?

Yes. As long as they recognize:

Read1: ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Read2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

Also, most of the third party kits configure primers at 10 uM, our protocol requires 25 uM, remember to reduce the final SPRI beads elution volume from 10 uL to 7 uL to make room for the primers.

 

What’s the minimal length of the target DNA?

>1,000 bp. Using DNA ladders that include fragments from 100 bp to 50,000bp, we found only when > 1,000 did the fragments get represented in the sequencing library generated by AFT™ Library Prep kit.

I didn't see the library smear

The possible reasons for no library amplification could be:

1). If single cell is sampled by dilution, the concentration of bulk cell suspension might be overestimated. Also by Poisson distribution, more than half of the sampling would contain no cell at all. Try to make three aliquots and make library from each of them.

2). If the single cell is collected by cell sorting, the tube may not catch the cell, try to collect three or more single cell in as many tubes and make library from each of the collection.

3)The DNA might be degraded and reduced to less than 1 kb; AFT ™ technology prefers to work on DNA longer than 1 kb. Try to keep cells intact before the procedure.

4). Excessive pipetting and vortexing during the workflow might reduce the target DNA to shorter than 1 kb, avoid excessive pipetting or vortexing.

5) When recovering the elution from SPRI beads, leave at least 3 uL behind, don’t try to recover all.

6). The third-party index primers are not compatible; some index primers are based on Nextera transposase recognition sites, not the standard Illumina Read1 and Read2 sequences.  The correct index primer structures should be like below:

P5(AATGATACGGCGACCACCGAGATCTACAC)-i5-Read1(ACACTCTTTCCCTACACGACGCTCTTCCGATCT)

P7(CAAGCAGAAGACGGCATACGAGAT)-i7-Read2(GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)

Comment

Manual download

Manual: AFT™ Linked-Reads Single-Cell Whole-Genome Library Preparation Kit

Video