Sale!

AFT™ Linked-Reads Whole-Genome Library Preparation Kit – 24 rxn

$1,296.00 $299.00

Description

AFT™ Linked-Reads Whole-Genome Library preparation technology seamlessly integrates the Amplification, Fragmentation, and Tagging of target DNA into one reaction, achieves ultimate efficiency in DNA sequencing Library preparation. AFT™ Linked-Reads Whole-Genome Library kit works with wide range of DNA input, from as low as single cell content to 10ng. The simple workflow comprises of 2 functional steps: AFT reaction of one hour at 45° C, and Library PCR of various cycles depending on the input DNA level, there is also a SPRI beads-based purification after each step.

Kit Components

ComponentVolume (uL)
DNA Denaturant12
2x AFT(TM) buffer120
AFT(TM) eyzymes12
2x PCR Master Mix600
i501 primer, 10uM60
i701 primer, 10uM60

Answered Question

At what temperature is the kit shipped?

Shipped on gel ice, needs to be kept at -20 °C or lower on receiving.

Can I use 3rd party or homebrew index primer sets to amplify the library?

Yes. If multiplexing, pick and record the index primers from index primer kits (third-party vendor, NEB E7600S, etc.). Be careful in selecting third-party index primers; some index primers are based on Nextera transposase recognition sites, not the standard Illumina Read1 and Read2 primer sequences. The correct index primer structures should be like below:
P5(AATGATACGGCGACCACCGAGATCTACAC)-i5-Read1(ACACTCTTTCCCTACACGACGCTCTTCCGATCT)
P7(CAAGCAGAAGACGGCATACGAGAT)-i7-Read2(GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)
Also, make sure the primers are at 10 uM concentration.

What’s the minimal length of the target DNA?

>1,000 bp. Using DNA ladders that include fragments from 100 bp to 50,000bp, we found only when > 1,000 did the fragments get represented in the sequencing library generated by AFT™ Library Prep kit.

Can I use the WG AFT™ Sequencing Library Prep kit for degraded DNA samples?

Might not. The strand displacement amplification step of the workflow requires the template DNA to be long enough, at least 1,000 bp and longer. So the kit would not work with DNA extracted from FFPE samples or cell free liquid biopsy samples.

No library amplification

The possible reasons for no library amplification could be:

1). The quantification of input DNA might be overestimated, try one or two more PCR cycles.
2). The DNA might be degraded and reduced to less than 1 kb; AFT ™ technology prefers to work on DNA longer than 1 kb. Try to extract DNA at low temperature with mild conditions, store the extracted DNA at -20 °C or lower.
3). Excessive pipetting and vortexing during the workflow might reduce the target DNA to shorter than 1 kb, avoid excessive pipetting or vortexing.
4) When recovering the elution from SPRI beads, leave at least 3 uL behind, don’t try to recover all.
5). The third-party index primers are not compatible; some index primers are based on Nextera transposase recognition sites, not the standard Illumina Read1 and Read2 sequences.  The correct index primer structures should be like below:
P5(AATGATACGGCGACCACCGAGATCTACAC)-i5-Read1(ACACTCTTTCCCTACACGACGCTCTTCCGATCT)
P7(CAAGCAGAAGACGGCATACGAGAT)-i7-Read2(GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)

PCR duplication rate is high

The PCR duplication rate from AFT™ kit is normally very low, less than 3%, you may underestimate the input DNA amount and run PCR with too many cycles, try to use fewer PCR cycles, as long as the library has a molar concentration of greater than 1 nM for 250-500 bp range, it will be sufficient for a sequencing.

Questions?

Manual download

Manual: AFT™ Linked-Reads Whole-Genome Library Preparation Kit

Video